University at Buffalo - The State University of New York
Skip to Content
PubMed Commons - NCBI
PubMed Commons enables authors to share opinions and information about scientific publications in PubMed.

Top comments now - more about this

  • Jonathan Eisen2017 Nov 12 12:44 p.m. (5 days ago) 3 of 3 people found this helpful

    I believe the claims regarding "beneficial" organisms in this paper are inaccurate and misleading. For example, consider statement in the abstract:

    "While the vast majority of microbial species classified were beneficial"

    No evidence is presented anywhere in the paper that the microbes they identify via sequence analysis are beneficial in any way. I engaged in a Twitter discussion with the senior author of this paper, Chris Mason, about this topic where we discussed my concerns. Details of this discussion are here: https://phylogenomics.blogspot.com/2017/11/flaws-in-prediction-of-presence-of.html

    As far as I can tell from this discussion and from the paper, the authors considered all organisms that were not specifically assigned to be a putative pathogen to be beneficial.

    This is simply a flawed approach.

    First, just because they are not assigned to be putative pathogenic does not mean that they are not pathogenic.

    Second, this ignores the possibility that microbes could have no effect. That is, some could be parasitic, some could be beneficial, and some could have no effect - what was the no effect category ignored?

    Third, the DNA could be coming from dead organisms that presumably would not have any significant effects.

    Overall, I believe this paper's claims regarding "beneficial" microbes are inappropriate and misleading.

  • Erick H Turner2017 Nov 16 12:49 p.m. (yesterday)

    The authors make mention of two approaches for dealing with publication bias. However, both of these can be classified as statistical approaches for use when the only data to which one has access is the published literature. Another approach: simply procure the missing data. Instead of relying on manuscript cohorts, one can look further “upstream” to inception cohorts of clinical trials. Examples of sources include regulatory data (e.g. Drugs@FDA), grants databases, and ClinicalTrials.gov.

Selected recent comments - more about this

  • Xinlai Cheng2017 Nov 17 03:52 a.m. (21 hours ago)

    Here is the gRNA sequence information for Stat3 Double Nickase Plasmid (h) : sc-400027-NIC:

    sc-400027-NIC Stat3 Double Nickase Plasmid (h): gcctagatcggctagaaaac sc-400027-NIC Stat3 Double Nickase Plasmid (h): gttgggcgggcctccaatgc

    we can also provide you our established cell line. Let me know if you want

  • Ian Shrier2017 Nov 16 08:28 a.m. (yesterday) 1 of 1 people found this helpful

    We completely agree on objectives and importance of estimating the per protocol effect. It is absolutely the effect that I am interested in as a patient, and therefore as a physician who wants to communicate important information to the patient.

    I do think we have different experiences on how people interpret the words "per protocol analysis". Historically, this term has been used to mean an analysis that does not estimate the per protocol effect except under unusual contexts. More recently, some have used it to refer to a different type of analysis that does estimate the per protocol effect. The field of causal inference is still relatively new and there are other examples of changing terminology. I expect the terminology will stabilize over the next 10 years, which will make it much easier for readers, authors and reviewers.

  • Franz Schelling2017 Nov 15 4:02 p.m. (2 days ago)

    Congratulations on this pioneering study! I would highly appreciate being granted a reprint (F. Schelling, Fingstr. 32, A-6974 Gaissau, Austria) or electronic copy of the entire paper (dr.franz.schelling@aon.at)

  • Mordecai P Blaustein2017 Nov 14 2:56 p.m. (3 days ago)

    The topic of "ouabain as a therapeutic agent" is discussed in the print version of this article ("The Pump, the Exchanger and the Holy Spirit..."). The print version will be published in the December 2017 issue of Am J Physiol Cell Physiol.

  • Hauke Fürstenwerth2017 Nov 15 07:23 a.m. (2 days ago)

    so will the on-line version of the article be retracted and replaced by an updated version, or will there be two versions?

  • Hauke Fürstenwerth2017 Nov 06 09:53 a.m.edited

    Are clinical experiences not relevant?
    In medical research, decisive results are obtained by clinical experiences. Hence, new hypotheses need to be checked for clinical findings and observations. Ouabain and the related Strophanthus glycoside k-strophanthin by default have been used for more than a century to treat heart diseases. Cymarin and convallatoxin (identical with β-antiarin) have also been used. As early as 1904, a standardized solution of pure ouabain was commercialized by E. Merck, Darmstadt as “g-Strophanthin crystallisatum nach Thoms”. This ouabain solution was used both intravenously [7] and orally administered in the treatment of heart diseases. In 1909, the French physician Henri Vaquez introduced the intravenous application of ouabain (“Ouabain-Arnaud”) in France. In World War I medical personnel in the German army by order of the ambulance corps exclusively used ouabain solutions to treat heart failure [4]. The therapeutic profile and the disease profiles for which the use of Strophanthus glycosides is appropriate are documented in many reports on clinical experiences and have been summarized in numerous reviews, preferably in the German literature [10]. As early as the first half of the 20th century distinguished scientists such as Albert Fraenkel, University of Heidelberg, and Ernst Edens, University of Dusseldorf, have published monographs [8,5] that document in detail the clinical effects of Strophanthus glycosides. In textbooks ouabain has been praised as "the biggest advance in cardiac therapy since Withering in 1785" [6]. Decades of clinical experience with ouabain provide a yardstick by which all research results and hypotheses related to ouabain have to be measured. Observations at the bedside are more meaningful than speculative hypotheses based on experimental research.

    In his article Mordecai P. Blaustein gives no reference to the comprehensive literature on clinical experience with ouabain. Although he concludes from his hypotheses that “ouabain and its receptor site participate in the pathogenesis of hypertension, cardiac hypertrophy and HF“ he does not even mention the fact that ouabain has been used successfully in medical therapy of heart failure.

    Contrary to well-documented positive clinical experience in the treatment of heart disease with ouabain, Blaustein asserts that ouabain damages the cardio-vascular system. He neglects current reports on cardio protection induced by ouabain [13,15,19] as well as conclusions by Lijune Liu and co-workers that ouabain can be beneficial to various stages of heart failure [14]. Blaustein asserts that ouabain raises blood pressure in humans, but at the same time admits that ouabain increases blood pressure only in selected rodents strains, because the susceptibility to ouabain-induced hypertension is genetically-determined. Thus there is no evidence to suggest that ouabain is hypertensinogenic in humans. In clinical experience a reduction of high blood pressure in patients is observed on treatment with ouabain [9].

    Blaustein asserts that in more than two centuries of clinical use of digoxin no hints have been found that digoxin is hypertensinogenic. However, it is common knowledge that Digitalis as well as Strophanthus glycosides in high enough concentration increase blood pressure [1,8]. The effects of cardiac glycosides are very sensitive to the applied dosage. Cardiac glycosides are prototypical examples of hormetic substances [10]. The hormetic nature of ouabain is also observed in the effect on signal transduction. According to the studies quoted by Blaustein in his article, low concentrations of ouabain activate signaling cascades, while high concentrations inhibit them.

    Ouabain has been used in clinical application to treat digitalis intoxication in patients. Corresponding reports are documented as early as 1902. Recent in vitro and in vivo studies confirm this well-known clinical observation [16]. So contrary to Blaustein’s hypothesis that digoxin prevents negative effects of ouabain, in clinical practise ouabain has been shown to prevent damage from digoxin. It is a frequently reported observation that Strophanthus glycosides also work in patients in whom digitalis glycosides have no effect, see for example the publication of the renowned cardiologists Franz Groedel and Bruno Kisch [11].

    The therapeutic effects of k-and g-strophanthin are largely identical, ouabain being slightly more potent than k-strophanthin [8,17]. In a double blind cross-over study Agostoni compared the effects of k-strophanthin and digoxin in 22 patients with advanced congestive heart failure [2]. K-strophanthin improved functional performance while digoxin failed to provide such results. Norepinephrine plasma level at rest was significantly lowered by k-strophanthin but not by digoxin.

    Based on all available data it can be ascertained that the mutually exclusive effects of ouabain and the inhibitor of the Na/K-ATPase observed in mammalian tissues do not support the hypothesis that this inhibitor is identical with ouabain, but favor the interpretation that “endogenous ouabain” is something different.

    Blaustein asserts that Hamlyn identified two ouabain isomers in rodent plasma that are absent from commercial (plant) ouabain. This assertion is not backed by the corresponding Hamlyn publication [12]. Therein Hamlyn reports the presence of several substances in plasma of pregnant rats that show immunoreactivity. Two substances are chromatographically slightly different from ouabain and have different mass spectra. Hamlyn does not provide any data for the elucidation of the chemical structure. The chemical structure of these products is unknown. So it is not justified to claim that these substances are isomers of ouabain.

    Nor does the existence of these unknown compounds in plasma of rats suggest that endogenous ouabain is of animal origin. A comparison of substances found in unpurified plasma with purified ouabain - ie free from impurities - is meaningless. Provided that these substances will be identified by structural analysis as isomers of ouabain then it still has to be examined whether these substances are also found in Strophanthus or Acokanthera extracts.

    References

    [1] Abelmann WH, 1973
    [2] Agostoni PG, 1994
    [4] https://sites.google.com/a/aryapa.faith/iosifpravin/albert-fraenkel-ein-arztleben-in-licht-und-schatten-1864-1938-reihe-ecomed-biographien-3609162600

    [5] Edens E, Die Digitalisbehandlung [Digitalis treatment] , Third edition, Berlin-München, Verlag Urban&Schwarzenberg, 1948

    [6] Eichholtz F, Lehrbuch der Pharmakologie [Textbook of Pharmacology], fifth edition, Berlin und Heidelberg, Springer Verlag, 1947.

    [7] Fleischmann P, Wjasmensky H. Ü̈ber intravenöse Strophanthintherapie bei Verwendung von gratus-Strophanthinum crystallisatum Thoms. Deutsche Medizinische Wochenschrift 35: 918–921, 1909

    [8] https://books.google.de/books?id=iq-kBgAAQBAJ&printsec=frontcover&hl=de&source=gbs_ge_summary_r&cad=0#v=onepage&q&f=false

    [9] https://doi.org/10.9734/BJMMR/2015/17042

    [10] Fürstenwerth H, 2016

    [11] https://doi.org/10.1016/S0025-7125(16)36725-6

    [12] Jacobs BE, 2012

    [13] Lagerstrom CF, 1988

    [14] Liu L, 2016

    [15] Morgan EE, 2010

    [16] Nesher M, 2010

    [17] PFEIFER E, 1960

    [19] Wu J, 2015

  • Marco Lotti2017 Nov 14 03:55 a.m. (3 days ago)

    Free download at: http://www.europeanreview.org/article/13615

    Please see also: Lotti M. A Coliseum with frail foundations: a critical analysis of the state-of-the-art open-abdomen HIPEC technique. Available at: https://www.slideshare.net/MarcoLotti3/a-coliseum-with-frail-foundations-a-critical-analysis-of-the-stateoftheart-openabdomen-hipec-technique

  • Gerardo Ferbeyre2017 Nov 12 10:14 a.m. (5 days ago)

    I have red this paper many times and I find always inspiration for experiments and new ideas. The authors condensed a tremendous body of work while keeping their main message beautiful and simple. In pancreatic cancer, inhibition of the RAS/MAPK pathway allows the emergence of a subpopulation of dormant tumor stem cell with increased dependency on mitochondria. We have reproduced many of the key characteristics of these pancreatic cancer stem cells using a different experimental model and I wonder whether this phenotype is unique to these cancer cells when they evolve or whether the cells are reactivating a primitive embryonic program of pancreatic epithelial stem cells.

  • Anne Niknejad2017 Nov 10 03:54 a.m. (7 days ago)edited

    erroneous information

    'C69652(B. subtilis LipB)'

    https://www.ncbi.nlm.nih.gov/nucest/C69652?report=genbank

    C69652 Yuji Kohara unpublished cDNA Caenorhabditis elegans cDNA clone yk365f3 5-, mRNA sequence

    Link should be instead:

    http://pir.georgetown.edu/cgi-bin/nbrfget?uid=C69652

    The UniProt entry corresponding to the enzyme B. subtilis LipB described in this paper is Q79F14

    http://www.uniprot.org/uniprot/Q79F14

  • Thomas Heston2017 Nov 09 9:29 p.m.edited

    This concept has stood the test of time. More and more research is showing beneficial effects of sauna bathing. An update of this topic is Sauna Bathing and the Cardiovascular System Int J Sci Res. 2017 Nov; 6(11) 569-570.

  • Thomas Heston2017 Nov 09 9:01 p.m.edited

    This is an interesting concept which could improve scientific research and trust in science. One possible shortcoming of their proposal is that they propose a private network as opposed to an open network with no central authority as proposed in the Blockchain-based scientific study (Digit Med 2017;3:66-8). These concepts of combining blockchain technology with smart contracts are a step in the right direction towards making research studies more reproducible, reliable, and trusted.

  • Eyal Shahar2017 Nov 09 1:12 p.m.

    A composite outcome: another example of thought bias

    <http://www.u.arizona.edu/~shahar/commentaries/Commentary composite outcomes.pdf>

  • Alvaro Alonso2017 Nov 09 08:08 a.m. 4 of 4 people found this helpful

    This paper reports that warfarin users had lower overall incidence rates of cancer than non-users in a large population-based cohort. The association was present for most cancers.

    One major limitations in this analysis, that puts into question the validity of the results, is the lack of adjustment for potential confounders. The reported models seem to only adjust for age and sex. The authors did not consider any other factor that may influence the decision to prescribe or not warfarin. It has been established that frail and sicker individuals are less likely to receive oral anticoagulation with warfarin, even if indicated, and to discontinue treatment (see for example PMID 19151165, 26277091 and 27471198).

    In summary, before concluding that a particular medication has a blanket anticancer effect, I would expect a more careful consideration of confounding.

  • Eyal Shahar2017 Nov 08 2:37 p.m.

    “Selection bias without colliders” was… effect‐modification bias x 3

    http://www.u.arizona.edu/~shahar/commentaries.html

  • Cicely Saunders Institute Journal Club2017 Nov 08 11:53 a.m. 2 of 2 people found this helpful

    We selected and discussed this paper at our monthly journal club on 1st November 2017.

    The paper generated a lot of discussion and we felt that this was an important concept, especially for clinicians, to think about. The topic of QALYs was unfamiliar to some of us and we found that the authors explained it very clearly in the paper. We were intrigued by the use of an integrative review method and discussed this at length. It may have been helpful to read more explanation of this method and know how it differs from other types of review methods. We also wondered about some of the inclusion/exclusion criteria such as the exclusion of reviews and the decision making process for the theoretical papers included. We enjoyed discussing the themes which emerged from this paper and the wider debate around the most appropriate measures for palliative care populations, particularly in light of the recent paper by Dzingina et al. 2017 (https://www.ncbi.nlm.nih.gov/pubmed/28434392). We feel this paper will be a useful educational resource.

    Commentary by Dr. Nilay Hepgul & Dr. Deokhee Yi on behalf of researchers at Cicely Saunders Institute of Palliative Care, Policy & Rehabilitation, King’s College London.

  • BSH Cancer Screening, Help-Seeking and Prevention Journal Club2017 Nov 08 06:57 a.m. 2 of 2 people found this helpful

    The BSH Cancer Screening, Help-Seeking and Prevention Journal Club read with great interest this paper, which we feel provides a useful addition to the literature. In this paper, the authors present a framework for the complex relations between cognition and affect in predicting health behaviour. The authors describe the model that is currently used most often in health behaviour research, which looks at the independent effects of cognition and effect on health behaviour (the “main effects approach”). They then convincingly argue that this model does not consider possible interconnections of thought and feeling and describe three alternative models that may be better at explaining subsequent health behaviour: a mediation model (either an affect-preceding-cognition model or a cognition-preceding-affect model), a moderation model, and a contextualised effects model, which are helpfully explained graphically in the Figure on page 3 of the paper. The authors also provide empirical evidence from the health behaviour literature to support each of these models, and argue that these complex relations should be routinely examined in health behaviour research.

    Our group recognised the importance and relevance of this topic to much of our work on the determinants and possible points for intervention in cancer screening, help-seeking, and cancer prevention. The authors provide a good reminder of how theory can be improved to better understand behaviour, which is relevant to our work on, for example, cancer screening as a teachable moment or cancer worry as determinant of screening uptake, but is also applicable to a wide range of other health behaviours such as smoking, exercise, and healthy eating.

    However, the paper also raised some questions in our group. First, it was unclear to us which model would be applicable under what circumstances. For example, is this a function of the behaviour or of the affective state that is under study, or could this also be construed as characteristic of an individual or group of individuals? For example, for some people, perhaps those who are more organised or conscientious, the cognition-preceding-affect model may better predict subsequent behaviour, while for others, perhaps those who are struggling to cope due to life difficulties or mental health issues, the affect-preceding-cognition model may better predict behaviour. The authors acknowledge that the models they present are “not mutually exclusive” (p.4), and so “multiple types of relations could be involved in determining engagement in a particular health behaviour” (p.4), but this does not provide much guidance on how these models might guide our formulation of hypotheses to be tested in a particular study. Relatedly, it is unclear how these models can (or should) be applied to existing health behaviour models, and to what extent they require an overhaul of these existing models. Our group noted that the inclusion of these complex relationships could water down existing theoretical models, especially if the specific relationship cannot be identified a priori on theoretical grounds but is a function of the behaviour, affective state, individual, or group under study. From the empirical examples that the authors provide throughout, it is unclear whether the complex relations in those studies were pre-specified based on theoretical grounds, or merely exploratory in nature. In their Discussion on p.11, the authors seem to acknowledge that inclusion of the often-neglected interconnections between cognition and affect will require an exploratory, theory-building approach. Our group would have found it helpful if the authors had provided more practical advice on how to formulate a priori hypotheses about these complex relations, and perhaps some worked examples.

    Other questions that were raised by our group are of a more pragmatic nature, such as what the implications of the inclusion of complex relations between cognition and affect would have on study sample size and power (especially if not pre-defined a priori but tested post hoc). A related concern was how to practically take the ideas presented by the authors forward, given that mediation and moderation analyses may require a slightly different skill set, and one that many social scientists may not be very familiar with.

    Overall, however, the group felt that these concerns -especially those of a more practical nature- do not override the importance of taking forward the excellent ideas presented in this paper, which could herald a new era for health behaviour research, both in terms of theory and practice.

  • Victoria MacBean2017 Nov 07 12:15 p.m.

    Plain English Summary:

    Neural respiratory drive (NRD) is commonly used as a measure of respiratory function, as it measures the overall muscular effort required to breathe in the presence of the changes that occur in lung disease. Both bronchoconstriction (airway narrowing) and hyperinflation (over-inflation of the chest, caused by air trapped in deep parts of the lung) occur in lung disease and are known to have detrimental effects on breathing muscle activity. Electromyography (EMG) is a measure of electrical activity being supplied to a muscle and can be used to measure the NRD leaving the brain towards respiratory muscles (in this study the parasternal intercostals – small muscles at the front of the chest). This study aimed to research the individual contributions of bronchoconstriction and hyperinflation on EMG and the overall effectiveness of the EMG as an accurate marker of lung function.

    A group of 32 young adults were tested as subjects for this study, all of which had lung function within normal limits at rest, prior to testing. The subjects inhaled increasing concentrations of the chemical methacholine to stimulate the contraction of airway muscles – imitating a mild asthma attack. Subjects’ EMG, spirometry (to measure airway narrowing) and IC (inspiratory capacity) was measured to test for hyperinflation. Detailed statistical testing was used to assess the relationships between all the measures.

    The results show that obstruction of the airway was closely related to the increase in EMG, however inspiratory capacity was not related. The data suggests that the overinflation of the chest had less of an effect on the EMG than the airway diameter (bronchoconstriction). This helps advance the understanding of how EMG can be used to assess lung disease.

    This summary was produced by Talia Benjamin, Year 13 student from JFS School, Harrow, London as part of the authors' departmental educational outreach programme.

  • Victoria MacBean2017 Nov 07 12:09 p.m.

    Plain English Summary:

    This study examined differences in children’s awareness of breathing difficulty, specifically the influence of weight and asthma. With obesity on the rise in Western society and asthma being a common long-term medical condition, it is crucial to understand why obese, asthmatic children report more breathlessness than asthmatic children who are not overweight, even when there are no differences in the severity of their asthma. It has previously been suggested that overweight children may have an increased awareness of breathing effort.

    This study compared various aspects of breathing across three groups of children: asthmatic children with healthy weight, overweight children with asthma and a control group of healthy weight children. The project involved the children breathing through a device which added resistance to breathing. Children were asked to rate how hard they felt it was to breathe, and the tests also measured the children’s breathing muscle activity to find out how hard the breathing muscles were working as the researchers purposefully increased the children’s effort to breathe.

    The anticipated results were that healthy weight asthmatic children and healthy weight children would show similar results, that is that their breathing effort scores would steadily increase as they found it harder to breathe, with the breathing muscles working gradually harder. Meanwhile, the overweight asthmatic children would show a much steeper increase.

    From the 27 children who were studied, the results showed that the overweight children gave higher effort scores throughout the tests, but that these increased at the same rate. There were no differences in the way the children’s breathing muscles responded to the tests. The reason for the higher overall effort scores in the overweight asthmatic children was that their muscles are already working harder than the other two groups before the experiment due to the changes that occur in the lung with increased weight. It was then concluded that overweight asthmatic children do not have differences in their awareness of breathing effort, but that their additional body mass means their muscles are already working harder.

    This summary was produced by Sarah Ezzeddine, Year 13 student from Harris Academy Peckham, London and Neta Fibeesh, Year 13 student from JFS School, Harrow, London as part of the authors' departmental educational outreach programme.

  • Victoria MacBean2017 Nov 07 09:16 a.m.

    Plain English Summary

    Cystic Fibrosis (CF) is a genetic disorder in which the genes that control the movement of salt and water in and out of cells are affected, this leads to a build up of mucus mostly in the lungs but also in the liver, pancreas and intestine. The aim of the study was to determine whether high intensity exercise tasks lead to fatigue (where the muscles become briefly less able to generate force) in the abdominal muscles or the diaphragm in patients with CF.

    Two groups of people were tested, one group with 10 patients with CF and the other group with 10 healthy subjects. On two different occasions the test subjects went to the lab to carry out tests. On the first occasion the subjects performed an exercise test to characterise the subjects in terms of their exercise performance and to also calculate a work rate, which was used in the second test. The second occasion involved a cycling endurance test, lung function and respiratory muscle strength testing taken on all subjects. Before and after the exercise tests, subjects underwent magnetic stimulation of their diaphragm and abdominal muscles to assess how much force the muscles could generate.

    Average exercise time was similar in the healthy subjects and those with cystic fibrosis, as was the intensity of exercise they performed during the test. The measurements taken show that there were not any significant changes in the responses to magnetic stimulation after exercise in both the healthy subjects and those with CF. A decrease the response to magnetic stimulation of greater than 15% is thought to be indicative of fatigue in respiratory muscles, however, none of the subjects saw a decrease larger than 15%, thus leading to the conclusion that fatigue did not occur in any of the subjects.

    The fact that that fatigue did not occur in the diaphragm or abdominal muscles after exercise in the patients with CF suggests that feelings of breathlessness and weakness in leg muscles may be more important in limiting exercise performance in those with CF. Further studies are needed in order to exactly understand the factors that hinder exercise performance of those with CF such as muscle function in non-respiratory muscles.

    This summary was produced by Amazing Grace Lawal, Year 13 student from Harris Academy South Norwood, London as part of the authors' departmental educational outreach programme.

Supplemental Content

PubMed Commons Blog

Collaborating to bring journal clubs to PubMed Commons: A librarian’s perspective

July 5, 2017
Univ of Kansas Nursing-imgJournal clubs can be a great tool in graduate and medical education. They provide opportunities for students to practice important skills: literature searching, critical reading, scholarly debate, and in some cases, even writing. Julie Hartwell shares how a collaboration with faculty on PubMed Commons got started and its initial impact. See full blog post

Search for comments

Find comments contributed by an author

Find publications with comments in PubMed

Include "has_user_comments[filter]" with the query or use the "Reader comments" filter in PubMed's side bar. Try it now

More tips for using PubMed Commons

We value your feedback

If you have questions, comments, or suggestions for improvements, please let us know.

Send feedback