University at Buffalo - The State University of New York
Skip to Content
PubMed Commons - NCBI
PubMed Commons enables authors to share opinions and information about scientific publications in PubMed.

Top comments now - more about this

  • Tanai Cardona2017 Nov 20 07:29 a.m. (yesterday)

    I had suggested a similar experiment in a blog post back in the day (June 19, 2013): http://tanaiscience.blogspot.co.uk/2013/06/ethanol-production-using-heterocyst.html

    Glad to see it worked and that my prediction for better ethanol production in the heterocysts wasn't too crazy after all. In any case, using cyanobacteria to produce biofuels might need rates many times higher for it to become of any use at all. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4364286/

    Well done! All the best, Tanai

  • Doug Altman2017 Nov 20 3:36 p.m. (yesterday) 3 of 3 people found this helpful

    This paper reports a simple descriptive survey of reports of randomised trials published in dermatology journals. It is not a meta-epidemiological study, which is a meta-analytic summary of subgroup analyses across multiple meta-analyses – see for example Sterne et al (Stat Med 2002) [PMID: 12111917].

  • Samira Vesali2017 Nov 21 06:58 a.m. (15 hours ago) 1 of 1 people found this helpful

    Natural conception and reproductive experiences in cancer survivors who stored reproductive material before their treatment In the October 2017 issue of human reproduction (vol: 17, Page:1-8), Hammarberg K, 2017, published an opinion piece arguing of 301 respondents who had tried to achieve pregnancy since completing cancer treatment almost all had succeeded, in most cases through natural conception,Hammarberg K, 2017. There are some worthwhile points were not considered in this study, even as limitations or reasons for caution, which are bias influencing their findings. First, relatively response rate. It is not possible to know whether people with better or worse survival were more or less likely to participate. Our thoughts on this issue is that cancer patients undergoing advanced stages likely did not tend to participate in the survey. As well, those with malignancy normally get more extensive chemotherapy, which can damage their reproductive system. Evidence has been shown that different chemotherapy regimens can affect the reproductive system differently, Long JP, 2016. However, cancer patients who were on malignant stages have likely lower life expectancy and less hope childbearing after their treatment. It is possible they are less inclined to look for and benefit from fertility preservation options to store their cryopreserved material. Second, we believe that it is important to view the findings within the context of the cancer type, stage and chemotherapy regimens of the participants, because all the mentioned factors can lead to use or not use the frozen reproductive material and are effective in the participants’ ability to get pregnant naturally (possibly mild chemotherapy which can preserve some of the ovarian reserve). Third, the cancer patients studied were recruited from 1995 to 2014, but as we know Human Fertility and Embryology Authority (HFEA) has given permission to the usage of frozen eggs in United Kingdom (UK) from 2000, Wise J, 2000, and American Society of Reproductive Medicine (ASRM) removed the label of “experimental” from oocyte freezing in 2013,Practice Committees of American Society for Reproductive Medicine., 2013 . So, giving single vision to all frozen materials of participants during this time period maybe is not correct. Earlier, the patients only could enjoy form the cryopreserved embryo and sperm, then ovarian tissue and more recently oocytes. Looking at the table II, the pregnancy achievement is presented as “as a result of ART with stored material” but is not presented separately. It is not clear that all usage of stored material are adequately cryopreserved gametes or embryos or not. Fourth, the essential problem we see is that age can be another confounding factor in this survey. Many of the people who have never tried to get pregnant may be in advanced age, but we do not know the age of those who did not respond or never tried to get pregnant. Reza Omani Samani1, Samira Vesali1* 1 Department of Epidemiology and Reproductive Health, Reproductive Epidemiology Research Center, Royan Institute for Reproductive Biomedicine, ACECR, Tehran, Iran Correspondence address: Department of Epidemiology and Reproductive Health, Royan Institute for Reproductive Biomedicine, Tehran, Iran. E-mail: samiravesali@yahoo.com.

Selected recent comments - more about this

  • Franz Schelling2017 Nov 21 1:09 p.m. (9 hours ago)

    2-dimensional statistics can't come to terms with 4-dimensional hemodynamic problems such as those illustrated by the Unmistakable MS lesions which reflect retrograde venous impacts - as those shown in tell-tale MRI series

    Please share a non-factional look at Dominik Meier's unquestionably stellar MRI sequences of a patient with multiple sclerosis.

    Isn't https://medium.com/@franzschelling/what-deals-the-brain-such-blows-synchronous-at-least-double-hits-in-an-exemplary-case-of-292877844500 or http://bit.ly/2hu3g9N proving without any shadow of a doubt:

    Such cases of multiple sclerosis are biomechanically primed hemodynamic and obviously venous conditions. Which need to be established as such, to be addressed with the adequate technical equipment and topical expertise.

    F. Schelling, M.D.

  • Ralph Brinks2017 Nov 21 08:15 a.m. (14 hours ago)

    The authors state that Hoyer and Brinks set up "a hypothetical (micro-simulated) population" with "a linear increase of diabetes incidence to age 70 years". It is not true that we performed a micro-simulation. Instead, we used analytical relations between incidence and prevalence as cited, e.g. Brinks R, 2014. The linear increase of the age-specific incidence is an approximation to the values reported in the original paper. We agree that this an approximation only.

    The key point we made is that ignoring mortality yields to biased estimates of the incidence. This point has not been - and cannot be - undermined by the authors. Thus, we strongly discourage the use of the Styblo method whenever mortality matters.

  • Samira Vesali2017 Nov 21 05:39 a.m. (16 hours ago)

    Natural conception and reproductive experiences in cancer survivors who stored reproductive material before their treatment

    In the October 2017 issue of human reproduction (vol: 17, Page:1-8), Hammarberg K, 2017, published an opinion piece arguing of 301 respondents who had tried to achieve pregnancy since completing cancer treatment almost all had succeeded, in most cases through natural conception,Hammarberg K, 2017. There are some worthwhile points were not considered in this study, even as limitations or reasons for caution, which are bias influencing their findings. First, relatively response rate. It is not possible to know whether people with better or worse survival were more or less likely to participate. Our thoughts on this issue is that cancer patients undergoing advanced stages likely did not tend to participate in the survey. As well, those with malignancy normally get more extensive chemotherapy, which can damage their reproductive system. Evidence has been shown that different chemotherapy regimens can affect the reproductive system differently, Long JP, 2016. However, cancer patients who were on malignant stages have likely lower life expectancy and less hope childbearing after their treatment. It is possible they are less inclined to look for and benefit from fertility preservation options to store their cryopreserved material. Second, we believe that it is important to view the findings within the context of the cancer type, stage and chemotherapy regimens of the participants, because all the mentioned factors can lead to use or not use the frozen reproductive material and are effective in the participants’ ability to get pregnant naturally (possibly mild chemotherapy which can preserve some of the ovarian reserve). Third, the cancer patients studied were recruited from 1995 to 2014, but as we know Human Fertility and Embryology Authority (HFEA) has given permission to the usage of frozen eggs in United Kingdom (UK) from 2000, Wise J, 2000, and American Society of Reproductive Medicine (ASRM) removed the label of “experimental” from oocyte freezing in 2013,Practice Committees of American Society for Reproductive Medicine., 2013 . So, giving single vision to all frozen materials of participants during this time period maybe is not correct. Earlier, the patients only could enjoy form the cryopreserved embryo and sperm, then ovarian tissue and more recently oocytes. Looking at the table II, the pregnancy achievement is presented as “as a result of ART with stored material” but is not presented separately. It is not clear that all usage of stored material are adequately cryopreserved gametes or embryos or not.
    Fourth, the essential problem we see is that age can be another confounding factor in this survey. Many of the people who have never tried to get pregnant may be in advanced age, but we do not know the age of those who did not respond or never tried to get pregnant. Reza Omani Samani1, Samira Vesali1* 1 Department of Epidemiology and Reproductive Health, Reproductive Epidemiology Research Center, Royan Institute for Reproductive Biomedicine, ACECR, Tehran, Iran Correspondence address: Department of Epidemiology and Reproductive Health, Royan Institute for Reproductive Biomedicine, Tehran, Iran. E-mail: samiravesali@yahoo.com.

  • Sudheendra Rao2017 Nov 20 10:47 p.m. (23 hours ago)edited

    Just an addition since KU955594 was not found in the paper. Literature search suggests that the probable zika strain used to detect seropositivity in India back in 1954 was Zika virus/M.mulatta-tc/UGA/1947/MR-766 (KU955594). Supporting literature is here http://www.jimmunol.org/content/jimmunol/72/4/248.full.pdf http://www.jimmunol.org/content/jimmunol/68/4/461.full.pdf http://www.jimmunol.org/content/jimmunol/68/4/441.full.pdf BLAST results indicate 86-89% identity at nucleotide level of Zika virus/M.mulatta-tc/UGA/1947/MR-766 to Indian strains gb|MF173409, gb|MF173410, gb|MF173411 whereas protein identity is patchy ranging from 81-100% in some regions.

  • Erin Frazee Barreto2017 Nov 20 4:47 p.m. (yesterday)

    The Cystatin C-Guided Vancomycin Dosing tool can be accessed using the mobile or web app 'Calculate' available at QxMD

    https://qxmd.com/calculate/calculator_449/vancomycin-dosing-based-on-egfr-creatinine-cystatin-c

  • Kenneth Witwer2017 Nov 19 5:00 p.m. (2 days ago) 1 of 1 people found this helpful

    This study suggests that approximately 20 microRNAs (miRNAs) in cerebrospinal fluid (CSF) may distinguish between different responses to exercise or between sedentary controls and individuals living with chronic fatigue syndrome (CFS, also known as myalgic encephalomyelitis, or ME) and Gulf War Illness (GWI). Funded by recent NIH efforts to support research into several related, poorly-understood and debilitating conditions, this report represents a large and commendable undertaking in terms of patient recruitment (182 individuals) and sample collection. Unfortunately, experimental and analytical issues limit interpretation of the results. I would like to highlight several of these here in the hopes of stimulating rigorous follow-up as appropriate.

    1) The choice of a threshold of 35 for a clearly noisy qPCR array. A Cq threshold (to distinguish noise from real signal) was assigned to Cq=35, higher than might have been supported by the negative controls. 82 "positive" negative control features were found in this dataset, with an average Cq of 35.6. 34 of these data points were below Cq 35, averaging 33.1, and several amplified before 25.9. This is a high false positive signal, raising concerns about specificity of the array and suggesting that a lower threshold might have been appropriate.

    2) The noise threshold was effectively ignored by adjusting all values above 35 (PCR noise) to 35. This replaced noise with "data" points and introduced a block of artificially invariable values. In a re-analysis after discarding Cq>35, at least half of the reported differences fall away or are smaller. Specifically, results for the following miRNAs appear to be affected by the Cq=35 adjustment: miR-99b-5p, miR-423-5p, miR-204-5p, miR-30d-5p; let-7i-5p, miR-200a-5p, and miR-93-3p (these three miRNAs also do not reach the 2/3 detection threshold in the exercise groups); miR-19b-3p, miR-505-3p, miR-532-5p, and miR-186-3p (for the latter, only one and two Cq<35 data points were gathered for the SC and CFS groups, respectively); and miR-22-3p and miR-9-3p (detected in only one group). miR-22-3p may remain significant, but the real difference between groups is about half the reported value.

    3) A miRNA was considered "expressed" in any one of the seven groups only if it was found in 2/3 of all samples. Unfortunately, this threshold was then ignored in analysis, when even miRNAs that were "expressed" in only one group were compared between groups. In some cases, miRNAs with only one or two amplifications in a group were reported (like miR-186-3p).

    4) No validation or measures of technical variability. First, there is no assessment of technical variability. The qPCR array gives one reading per miRNA per sample, with the exception of a negative control, read twice. Reading the same sample on three or four arrays would show how precise the readings are. Some of the miRNAs have up to 15-cycle detection ranges (even with Cq=35 as the cutoff) within groups. This represents a >32,000-fold range if it is an accurate measure of abundance. As a result, the purported differences between groups are often overshadowed by large standard deviations. It is unclear how much of this variability is technical, thus it is difficult to assign any differences to biology. Second, no findings are validated by individual assays. Instead of, or in addition to, technical array repeats, individual qPCR assays are routinely used in RNA biomarker studies to confirm profiling findings. These experiments are relatively cheap and permit multiple technical replicates for each sample. Third, no spike-ins are reported (RNA extraction efficiency) nor is there quality control of RNA prior to array measurements. While I can understand that the authors's enthusiasm might have spurred them to proceed without some standard procedures, it is perplexing that reviewers (and editors) would not ask for these crucial experiments.

    Despite these critiques, there are several findings that appear to be supported by a reanalysis (excluding Cq>35). These include the finding of 40-fold decreased abundance of miR-328 in CSF of exercised versus non-exercised individuals (although this is not restricted to any particular disease group), and, to a lesser extent (8-fold), miR-608. While validation is needed, and ideally a before-and-after study (in animals if this is too demanding in humans), at least these miRNAs may justify follow-up. Several other miRNAs are also significantly different between the two groups, but with large variability, diminishing their likely utility as biomarkers. However, with most of the purported CFS or GWI differences confounded by the thresholding strategies, and with no validation, additional evidence will be needed before other conclusions can be drawn. Notably, there was no discernible pattern of neuronal, oligodendrocyte (providing myelin sheath), or inflammation-associated miRNAs, which one might expect with damage or inflammation associated with CFS/ME or the acetylcholinesterase-linked mechanisms for GWI that is mentioned, so I am doubtful that this avenue of investigation will be fruitful.

    Patients of CFS/ME not only have to live with this condition, they have been through a lot in recent years with irreproducible science. I would thus encourage the authors both to moderate speculation about CFS or GWI-associated miRNAs for now and to proceed with and report the results of blinded qPCR quantification. I would recommend using the standard stem-loop RT/TaqMan assays for this. Indeed, I would be glad to examine samples along with you in a blinded fashion if it would be helpful.

  • Harri Hemila2017 Nov 19 12:34 p.m. (2 days ago)

    The three novel principles for EBM are old: the emperor has no clothes

    In their paper, Djulbegovic B, 2017 describe three novel principles for EBM.

    Djulbegovic and Guyatt write (p. 416): “the first EBM epistemological principle is that not all evidence is created equal, and that the practice of medicine should be based on the best available evidence.”

    There is no novelty in that statement. Even before 1992 scientists including those in the medical fields, understood that some types of research give more reliable answers.

    Furthermore, Djulbegovic and Guyatt do not follow the first principle in their own paper. They write (p. 416): “Millions of healthy women were prescribed hormone replacement therapy [HRT] on the basis of hypothesised reduction in cardiovascular risk; randomised trials refuted these benefits and demonstrated that hormone replacement therapy increased the incidence of breast cancer.”

    In an earlier paper, Vandenbroucke JP, 2009 wrote “Recent reanalyses have brought the results from observational and randomised studies into line. The results are surprising. Neither design held superior truth. The reasons for the discrepancies were rooted in the timing of HRT and not in differences in study design.” In another paper, Vandenbroucke JP, 2011 wrote “Four meta-analyses contrasting RCTs and observational studies of treatment found no large systematic differences … the notion that RCTs are superior and observational studies untrustworthy … rests on theory and singular events”.

    Djulbegovic and Guyatt thus reiterate old assumptions about the unambiguous superiority of RCTs compared with observational studies. They do not follow their own first EBM principle that arguments ”should be based on the best available evidence”. The above mentioned Vandenbroucke’s papers had already been published and were therefore available; thus they should have been taken into account when Djulbegovic and Guyatt argued for the superiority of RCTs in 2017.

    Djulbegovic and Guyatt further write (p. 416): “the second [EBM] principle endorses the philosophical view that the pursuit of truth is best accomplished by evaluating the totality of the evidence, and not selecting evidence that favours a particular claim.”

    There is no novelty in espousing that principle either. Objectivity has been a long term goal in the natural sciences, and also in the medical fields.

    Furthermore, Djulbegovic and Guyatt do not follow the second principle in their own paper. Their reference 94 is to the paper by Lau J, 1992, to which Djulbegovic ja Guyatt refer with the following statement (p. 420): “the history of a decade-or-more delays in implementing interventions, such as thrombolytic therapy for myocardial infarction.” However, in the same paper, Lau J, 1992 also calculated that there was very strong evidence that magnesium was a useful treatment for infarctions with an OR = 0.44 (95% CI: 0.27 - 0.71). However, in the ISIS-4 trial, magnesium had no effects: “Lessons from an effective, safe, simple intervention that wasn't ”, see Egger M, 1995.

    Thus, Djulbegovic and Guyatt cherry picked one intervention (trombolytic therapy) to support their statement that many interventions should have been taken into use much more rapidly, but they dismissed another intervention in the paper by Lau J, 1992, that would serve as an unequivocal counter example of the same statement. This surely is an example of “selecting evidence that favours a particular claim”.

    Principles 1 ja 2 had already been advocated in James Lind’s book on scurvy (1753), which was listed as reference number 1 in Djulbegovic B, 2017. Lind wrote: “As it is no easy matter to root out old prejudices, or to overturn opinions which have acquired an establishment by time, custom and great authorities; it became therefore requisite for this purpose, to exhibit a full and impartial view of what has hitherto been published on the scurvy; and that in a chronological order, by which the sources of those mistakes may be detected. Indeed, before this subject could be set in a clear and proper light, it was necessary to remove a great deal of rubbish.” See Milne I, 2012.

    Thus, Djulbegovic ja Guyatt’s EBM principles 1 and 2 are not new; they are at least over 250 years old.

    Djulbegovic and Guyatt write further (p. 416): “the third epistemological principle of EBM is that clinical decision making requires consideration of patients’ values and preferences.”

    The importance of patient autonomy is not an innovation that is attributal to EBM, however.

    When the EBM-movement started with the publication of the JAMA (1992) paper by the Evidence-Based Medicine Working Group., 1992, there was novelty in the proposals. The suggestion that each physician should himself or herself read original literature to the extent proposed by EBM enthusiasts in 1992 was novel as far as I can comprehend from the history. The strength of the suggestion to restrict to RCTs as the source of valid evidence about the efficacy of medical interventions was also novel as far as I can see. Thus, the Evidence-Based Medicine Working Group., 1992 had novel ideas and described the background for those ideas. We can disagree about the 1992 proposals  as many have done  but I do not consider that it is fair to claim that the JAMA (1992) paper had no novelty.

    In contrast, the aforementioned three principles described by Djulbegovic B, 2017 are not novel. The principles can be traced back to times long before even 1992. In addition, none of the principles alone or in combination set any unambiguous demarkation line as to what EBM is in 2017 and what it is not. How does evidence-based medicine differ from “ordinary” medicine, which has been using the same three principles for ages. If there is no difference between the two, why should the “evidence-based” term be used instead of simply writing “medicine”.

    In their paper, Djulbegovic and Guyatt also describe their visions for the future, but I cannot see that any of their visions is specific to EBM. We could as well write their visions for future by changing “EBM” to “medicine”.

  • Gwinyai Masukume2017 Nov 19 06:18 a.m. (2 days ago) 1 of 1 people found this helpful

    The authors define this pregnant patient’s Haemoglobin (Hb) of 8.9 g/dL as mild anemia. However according to the World Health Organization (WHO) this is moderate anemia (Hb < 10 but >= 7 g/dL) (WHO, 2011).

    It is suggested that theirs is the first case report describing an HIV infected pregnant patient with uncorrected Tetralogy of Fallot. In 2011 Solanki and co-authors reported such a case Solanki SL, 2011.

  • Mark Milton2017 Nov 18 4:37 p.m. (3 days ago) 1 of 1 people found this helpful

    This article states that "Eculizumab is a humanized monoclonal antibody directed against the C5a component of the complement system, and this binding leads to blockade of the C5b-9 membrane attack complex while the other functions of the complement are maintained."

    This is incorrect. Eculizumab, specifically binds to the C5, thereby inhibiting its cleavage to C5a and C5b and preventing the generation of the terminal complement complex C5b-9

  • Zoe Pafili2017 Nov 18 2:34 p.m. (3 days ago) 1 of 1 people found this helpful

    Even though not significant for the manuscripts' conclusions, the coefficient used to calculate dextrose calories (4kcal/g) is different from that proposed by the products' manufacturers and that used in TPN ordering, according to which the caloric content of IV dextrose is 3.4kcal/g.

  • Anthony Michael2017 Nov 18 07:13 a.m. (3 days ago)

    This article addresses the degradation of the polyamine spermine (Spm) by a strain of Bacillus subtilis used in the fermentation of soybeans to produce the Japanese fermented foodstuff “natto”. The authors have paraphrased half a sentence from a review of mine that dramatically misrepresents the whole sentence and meaning. In their article, the authors state, “However, it is widely accepted that bacteria do not produce Spm (Michael, 2016) and direct degradation of Spm by B. subtilis (natto) is unproven.” In fact, my review stated, “It had been accepted dogma that bacteria do not produce spermine (77); however, that supposition was incorrect, and in fact Spm has been detected in diverse bacteria (25).” (Michael, A.J. (2016) Polyamines in Eukaryotes, Bacteria and Archaea. J. Biol. Chem. 291, 14896-903 PMID: 27268252). In an age of fake news, this could be construed as fake citation.

  • Christopher Southan2017 Nov 18 06:54 a.m. (3 days ago)edited

    As a more convenient alternative to supplementary data or figshare, NAR were enlightened in accommodating pointers to our own blog posts (http://www.guidetopharmacology.org/news.jsp). We will thus now be able to update these

    Note also this paper follows on from our 2016 effort https://www.ncbi.nlm.nih.gov/pubmed/26464438 so please switch to the 2018 for future citations

  • In reply to a comment by Franz Schelling2017 Oct 17 2:16 p.m.

    Kenneth J Smith2017 Nov 18 06:10 a.m. (3 days ago)

    The authors do not believe they have deepened any misconceptions. First, we make no claims that Dawson’s fingers are identical to arterial border zones. However, the fact that many MS lesions bear a relationship with arterial border zones has been clearly established, not least in the several detailed studies of thousands of lesions that we cite from other groups. Second, we do not claim that oligodendrocytes’ metabolic demands are generally as high as those of neurons. We do claim that oligodendrocytes are particularly vulnerable to hypoxia, and this is the experience of many investigators. We devote a section to this topic in our manuscript.

  • In reply to a comment by Franz Schelling2017 Oct 22 3:44 p.m.

    Kenneth J Smith2017 Nov 18 06:09 a.m. (3 days ago)

    The authors agree that it is well established that the grey matter has a higher metabolic rate than the white matter, and this is in accord with the higher vascular density in the grey matter. This fact does not address whether oligodendrocytes are particularly susceptible to tissue hypoxia. There is widespread experience that oligodendrocytes are very vulnerable, although the underlying reasons remain unclear. The location of oligodendrocytes in the white matter accentuates their vulnerability, not only due to the relative paucity of the vasculature, but also because of the propensity of the white matter vasculature to contain relatively deoxygenated blood.

  • Xinlai Cheng2017 Nov 17 03:52 a.m. (4 days ago)

    Here is the gRNA sequence information for Stat3 Double Nickase Plasmid (h) : sc-400027-NIC:

    sc-400027-NIC Stat3 Double Nickase Plasmid (h): gcctagatcggctagaaaac sc-400027-NIC Stat3 Double Nickase Plasmid (h): gttgggcgggcctccaatgc

    we can also provide you our established cell line. Let me know if you want

  • Erick H Turner2017 Nov 16 12:49 p.m. (5 days ago) 1 of 1 people found this helpful

    The authors make mention of two approaches for dealing with publication bias. However, both of these can be classified as statistical approaches for use when the only data to which one has access is the published literature. Another approach: simply procure the missing data. Instead of relying on manuscript cohorts, one can look further “upstream” to inception cohorts of clinical trials. Examples of sources include regulatory data (e.g. Drugs@FDA), grants databases, and ClinicalTrials.gov.

  • Ian Shrier2017 Nov 16 08:28 a.m. (5 days ago) 1 of 1 people found this helpful

    We completely agree on objectives and importance of estimating the per protocol effect. It is absolutely the effect that I am interested in as a patient, and therefore as a physician who wants to communicate important information to the patient.

    I do think we have different experiences on how people interpret the words "per protocol analysis". Historically, this term has been used to mean an analysis that does not estimate the per protocol effect except under unusual contexts. More recently, some have used it to refer to a different type of analysis that does estimate the per protocol effect. The field of causal inference is still relatively new and there are other examples of changing terminology. I expect the terminology will stabilize over the next 10 years, which will make it much easier for readers, authors and reviewers.

  • Franz Schelling2017 Nov 15 4:02 p.m. (6 days ago)

    Congratulations on this pioneering study! I would highly appreciate being granted a reprint (F. Schelling, Fingstr. 32, A-6974 Gaissau, Austria) or electronic copy of the entire paper (dr.franz.schelling@aon.at)

  • In reply to a comment by Mordecai P Blaustein2017 Nov 14 2:56 p.m. (7 days ago)

    Hauke Fürstenwerth2017 Nov 15 07:23 a.m. (6 days ago)

    so will the on-line version of the article be retracted and replaced by an updated version, or will there be two versions?

Supplemental Content

PubMed Commons Blog

Collaborating to bring journal clubs to PubMed Commons: A librarian’s perspective

July 5, 2017
Univ of Kansas Nursing-imgJournal clubs can be a great tool in graduate and medical education. They provide opportunities for students to practice important skills: literature searching, critical reading, scholarly debate, and in some cases, even writing. Julie Hartwell shares how a collaboration with faculty on PubMed Commons got started and its initial impact. See full blog post

Search for comments

Find comments contributed by an author

Find publications with comments in PubMed

Include "has_user_comments[filter]" with the query or use the "Reader comments" filter in PubMed's side bar. Try it now

More tips for using PubMed Commons

We value your feedback

If you have questions, comments, or suggestions for improvements, please let us know.

Send feedback