University at Buffalo - The State University of New York
Skip to Content
PubMed Central, Table 1: Appl Environ Microbiol. 2012 March; 78(6): 2059–2062. doi: 10.1128/AEM.07461-11
PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

Logo of aemPermissionsJournals.ASM.orgJournalAEM ArticleJournal InfoAuthorsReviewers
 

Table 1

Oligonucleotide primers used in this study

PrimerSequenceaNoteDirectionb
P1CCGAATCTCGGCACCTGT5′-Flanking region of prcAF
P2GCGTAACATACTCGTCCTCCTATAAAT5′-Flanking region of prcAR
P3GGAGGACGAGTATGTTACGCAGCAGCAACGaacCm cassetteF
P4GACCTCCTTAGGTGGCGGTACTTGGGaacCm cassetteR
P5GCCACCTAAGGAGGTCTTTAAGATGAAG3′-Flanking region of prcAF
P6GATAGTGCCCGAACAGTG3′-Flanking region of prcAR
P7ATGTTACGCAGCAGCAACGaacCmF
P8TTAGGTGGCGGTACTTGGGaacCmR
P9GCTGCGGCGTTATGGTGTDetected prcAF
P10CCGTCGTCGAGGGGAAAGDetected prcAR
P11GCAGCGGGTACAAAGATAC5′-Flanking region of prcBF
aThe underlined sequences are engineered overlapping sequences for PCR amplifications.
bF, forward; R, reverse.